Anonyx sarsi Steele & Brunel, 1968

Primary tabs

EOL Text

Statistics of barcoding coverage: Anonyx sarsi:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 36
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=111725

Barcode data: Anonyx sarsi:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACCCTTTATTTTATTCTAGGTGCTTGAGCAAGTGCTATTGGAACATCCTTAAGATTAATTATCCGGTCCGAACTTAGAACTCCTAGTTGTTTAATTGGAGATGACCAAATTTACAACACTATAGTGACAGCACACGCTTTTATTATAATTTTTTTTATAGTCATACCTATTATAATTGGGGGTTTTGGAAATTGATTGGTCCCTTTAATATTAGGTAGTCCTGATATAGCCTTTCCACGAATAAATAATATAAGATTCTGACTATTACCCCCTTCTTTAACTCTTTTATTAGTAAGAAGTTTAGTTGAAAGAGGAGTTGGTACAGGTTGAACAGTTTATCCTCCTTTAGCTTCTTCTGCTGCTCATGGGGGGAGATCAGTAGATCTAGCTATTTTTTCACTACATCTAGCAGGAGCTTCTTCAATCCTAGGGGCTATTAATTTTATCTCAACAGTAATTAATATACGAAGACCAGGTATACCTATAGACCAAATACCATTATTTGTTTGATCTGTGTTTATCACAGCAATTCTTCTTTTATTATCTTTACCTGTGTTAGCAGGTGCAATCACTATACTTCTTACTGACCGAAATATTAATACTTCTTTTTTTGACCCTAGTGGAGGGGGTGATCCTATCTTATACCAACATTTATTC
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=111725

Distribution:

Canadian part of the Arctic Ocean, Cobscook Bay, European waters (ERMS scope), Gulf of Maine, Gulf of St. Lawrence, Manicouagan, North West Atlantic, Saint Lawrence River, United Kingdom Exclusive Economic Zone

  • North-West Atlantic Ocean species (NWARMS)
  • Trott, T.J. 2004. Cobscook Bay inventory: a historical checklist of marine invertebrates spanning 162 years. Northeastern Naturalist (Special Issue 2): 261 - 324.
  • Bellan-Santini, D.; Costello, M.J. (2001). Amphipoda, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 295-308
  • MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.  
  • Miller, Roberta. 2011. The St. Anne de Bellevue Arctic Biological Station Collection In Museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
  • Mark, S., Provencher, L., Albert, E. et Nozères, C. 2010. Cadre de suivi écologique de la zone de protection marine Manicouagan (Québec) : bilan des connaissances et identification des composantes écologiques à suivre. Rapp. tech. can. sci. halieut. aquat. 2914 : xi + 121 p
  • Miller, Roberta. 2012. The museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorKennedy, Mary, Costello, Mark, World Register of Marine Species
Sourcehttp://www.marinespecies.org/aphia.php?p=taxdetails&id=102516

Distribution:

western North Atlantic south to Rhode Island

Licensehttp://creativecommons.org/licenses/by/4.0/
Rights holder/AuthorThis work is licensed under a Creative Commons Attribution-Share Alike 4.0 License
Sourcehttp://www.marinespecies.org/aphia.php?p=taxdetails&id=102516

Allotype for Anonyx sarsi Steele & Brunel
Catalog Number: USNM 135064
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male;
Preparation: Alcohol (Ethanol); Slide
Collector(s): Bowman & Amory
Year Collected: 1927
Locality: Matamek River, North Side Of River, Mouth Of St. Lawrence River, Quebec, Canada, North Atlantic Ocean

  • Allotype:
Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorThis image was obtained from the Smithsonian Institution. Unless otherwise noted, this image or its contents may be protected by international copyright laws.
Sourcehttp://collections.mnh.si.edu/search/iz/?irn=99029

Holotype for Anonyx sarsi Steele & Brunel
Catalog Number: USNM 135063
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Alcohol (Ethanol); Slide
Collector(s): Bowman & Amory
Year Collected: 1927
Locality: Matamek River, North Side Of River, Mouth Of St. Lawrence River, Quebec, Canada, North Atlantic Ocean

  • Holotype:
Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorThis image was obtained from the Smithsonian Institution. Unless otherwise noted, this image or its contents may be protected by international copyright laws.
Sourcehttp://collections.mnh.si.edu/search/iz/?irn=99028

Paratype for Anonyx sarsi Steele & Brunel
Catalog Number: USNM 103666
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): Amory & Bowman
Year Collected: 1927
Locality: Matamek River, Shore, Quebec, Canada

  • Paratype:
Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorThis image was obtained from the Smithsonian Institution. Unless otherwise noted, this image or its contents may be protected by international copyright laws.
Sourcehttp://collections.mnh.si.edu/search/iz/?irn=78462

Habitat:

intertidal, infralittoral and circalittoral of the Gulf and estuary

Licensehttp://creativecommons.org/licenses/by/4.0/
Rights holder/AuthorThis work is licensed under a Creative Commons Attribution-Share Alike 4.0 License
Sourcehttp://www.marinespecies.org/aphia.php?p=taxdetails&id=102516

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 169 - 203
  Temperature range (°C): 0.091 - 0.936
  Nitrate (umol/L): 5.211 - 5.416
  Salinity (PPS): 34.932 - 34.933
  Oxygen (ml/l): 7.300 - 7.434
  Phosphate (umol/l): 0.640 - 0.646
  Silicate (umol/l): 5.656 - 5.713

Graphical representation

Depth range (m): 169 - 203

Temperature range (°C): 0.091 - 0.936

Nitrate (umol/L): 5.211 - 5.416

Salinity (PPS): 34.932 - 34.933

Oxygen (ml/l): 7.300 - 7.434

Phosphate (umol/l): 0.640 - 0.646

Silicate (umol/l): 5.656 - 5.713
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Licensehttp://creativecommons.org/publicdomain/mark/1.0/
Rights holder/AuthorOcean Biogeographic Information System
Sourcehttp://www.iobis.org/mapper/?taxon_id=826259

Depth range based on 118 specimens in 1 taxon.
Water temperature and chemistry ranges based on 87 samples.

Environmental ranges
  Depth range (m): 1 - 280
  Temperature range (°C): -1.363 - 12.177
  Nitrate (umol/L): 1.242 - 8.788
  Salinity (PPS): 27.165 - 35.134
  Oxygen (ml/l): 4.958 - 7.746
  Phosphate (umol/l): 0.097 - 1.240
  Silicate (umol/l): 1.323 - 20.682

Graphical representation

Depth range (m): 1 - 280

Temperature range (°C): -1.363 - 12.177

Nitrate (umol/L): 1.242 - 8.788

Salinity (PPS): 27.165 - 35.134

Oxygen (ml/l): 4.958 - 7.746

Phosphate (umol/l): 0.097 - 1.240

Silicate (umol/l): 1.323 - 20.682
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Licensehttp://creativecommons.org/publicdomain/mark/1.0/
Rights holder/AuthorOcean Biogeographic Information System
Sourcehttp://www.iobis.org/mapper/?taxon_id=678971
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith